-
Conditions treated: Infectious Diseases, Cholera
Treating Cholera with Cucumber leaves juice.
Cucumber/ Cucurbita/ Cucumis sativus is a very good moisturizer and helps in preventing scaling and chipping of skin. Cucumber also contains alkaloids...
-
Conditions treated: Infectious Diseases, Cholera
Treating Cholera with Bixa orellana leaves extracts
Bixa orellanais the scientific name for Achiote, Achiotec, Achiotl, Achote, Annatto, Urucu, Beninoki, Bija, Eroya and Jafara. It is a profusely fruit...
Enterotoxin Guide
- Summary
- Definition
Definition
An enterotoxin is a harmful substance produced by certain bacteria. The substance enters your intestines, causing stomach problems such as cramps and diarrhea. See: Food poisoning
Keep reading...
Encyclopedia: Enterotoxin
An enterotoxin is a protein toxin released by a microorganism in the intestine. Enterotoxins are frequently cytotoxic and kill cells by altering the permeability of the epithelial cells of the intestinal wall. They are mostly pore forming toxins, secreted by bacteria, that assemble to form pores in cell membranes. This causes the cells to die. The death of cells that form the barrier between the intestinal lumen and the surrounding...
Question and Answer
Production of enterotoxin is a characteristic of?
A. Clostridium botulinum B. Clostridium perfringens C. Clostridium difficile D. Clostridium tetani E. All of the choises are correct Which...
A. Clostridium botulinum B. Clostridium perfringens C. Clostridium difficile D. Clostridium tetani E. All of the choises are correct Which...
Yeah, Clostridium difficile AND Clostridium perfringens produce enterotoxins I'm guessing that in the strictest form of enterotoxin (a protein exotoxin that disrupts the lining of the gastrointestinal tract.), the answer would...
Asked by alchem - 20 months ago
How to design a set of Primers?
CACAAACAATCTGAATTAATTCGA This is the partial nucleotide sequence for bceT (bacillus cereus enterotoxin T) I am trying...
CACAAACAATCTGAATTAATTCGA This is the partial nucleotide sequence for bceT (bacillus cereus enterotoxin T) I am trying...
I see your stop codon near the middle of this sequence, unless your last three bps are TGA and not CGA (I will assume that your last three bp is...
Asked by Nismo75 - 2 months ago
Forum Search
-
DAN doctor wants these tests done... what do you think?...
enterotoxin I just want to make sure all these are necessary- We talked about chelating down the road. He Well, we saw Dr. Demio today and a lot of what he recommended I am already doing. He wants ...
Nov 08, 2005
-
J&K Dec 7 questions part1
amoebocyte lysate assay is used to detect a endotoxin b Enterotoxin c Cytotoxin d Neurotoxin Q1 which is the cause of simple goitre in children 1iodine transport defect 2Goitrogen 3 thyroiditis...
Dec 16, 2003
-
3,400 Malaysia food items deemed health risk
cause typhoid, and Staphylococcus aureus enterotoxin, which is the culprit in most cases of food SO WHAT S SAFE TO EAT NOW?: Eat at your own risk SOME 3,400 food items were deemed a health...
Dec 31, 2007
Complementary and Alternative Medicine
See results for: Cholera, Infectious Diseases
Related in the Kosmos
Disease
Physiology
Protein
Biology
Toxin
Bacteria